faecalis and ddl E. feacium genes. The primers used were: 5′CAAACTGTTGGCATTCCACAA3′ PF-562271 cost and 5′TGGATTTCCTTTCCAGTCACTTC3′ (E. faecalis forward and reverse primers respectively); and 5′GAAGAGCTGCTGCAAAATGCTTTAGC3′ and 5′GCGCGCTTCAATTCCTTGT3′ (E. faecium forward and reverse primers respectively) [29]. Antibiotic susceptibility testing Antibiotic resistance phenotypes were determined by the disc diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) recommendations [33]. Saline suspensions of isolated colonies selected from an 18-24 hour Brain Heart Infusion agar (Oxoid, Australia)

plates were prepared and suspension turbidity was adjusted to an equivalent of a 0.5 Mc Farland standard and inoculated onto Mueller Hinton agar (Oxoid, Australia) using sterile cotton swabs. Antibiotic discs for ampicillin (AMP, 10 μg), ciprofloxacin (CIP, 5

μg), gentamicin (GEN, 10 μg), tetracycline (TET, 30 μg), and vancomycin (VAN, 30 μg), were placed onto the surface of each inoculated plate. The diameters of antibiotic inhibition zones were measured and recorded as Selleck Fluorouracil susceptible (S), intermediate resistant (IR) or resistant (R) according to CLSI M02-A10. E. faecalis ATCC 29212 and Staphylococcus aureus ATCC 25923 were used for quality control. DNA Extraction Enterococcal strains were sub-cultured into Brain Heart Infusion broth (Oxoid, Australia) and incubated at 37°C overnight. A 400 μl aliquot of an overnight culture was used for DNA extraction. The Corbett X-tractor Gene automated DNA extraction system was used to extract DNA from all cultured isolates (Corbett Robotics, Australia) using the Core protocol No.141404 version 02. The automated DNA extraction system allows for the simultaneous extraction of DNA from 96 isolates. The quality and quantity of the DNA was high, yielding 98 ug/ml Acesulfame Potassium DNA on average and with a mean 260:280 absorbance ratio of 1.85. SNP profiling of E. faecium and E. faecalis by Allele-specific Real-Time PCR A method for a highly-discriminatory SNP genotyping method for E. faecium and E. faecalis, has been developed by our group

[29]. In total, 55 E. faecalis and 53 E. faecium isolates were genotyped by the SNP method using Allele-specific real-time PCR (RotorGene 6000, Corbett Robotics). Each reaction contained 2 μl of DNA which was added to 8 μl of reaction master mix containing 5 μl of 2 × SYBRGreen® PCR Mastermix (Invitrogen, Australia) and 0.125 μl of reverse and forward primers (20 μM stock, final concentration 0.5 μM) [29]. Cycling conditions were as follows: 50°C for 2 min, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds, and a melting stage of 60°C-90°C. Each isolate was tested in duplicate and No Template Controls (NTCs) were used for each primer set as well. An isolate specific SNP profile for all E. faecium and E. faecalis was generated consisting of the polymorphism present at each of the SNPs.